vamos is a tool to perform motif annotation of VNTR sequences from long-read assemblies or mapped long-read BAMs. Variant calls are produced from BAMs by prephasing sequences if no phase information is available, a max-cut heuristic is applied to phase reads. Annotation is then called on consensus sequences constructed from partial-order alignment of reads in each haplotype (or all reads if in an autozygous region).
The motifs used to annotate TR sequences are selected from TR annotations of long-read assemblies. An optimization routine is used to select a subset of motifs from all observed motifs at each locus so that the sequences used for annotation likely reflect true motif variation and not sequencing error.
Vamos guarantees that the encoding sequence is winthin a bounded edit distance of the original sequence for the genomes used to compile the motif database.
For example, a VNTR sequence ACGGT|ACTGT|ACGT may be encoded to a more compact representation: ACGGT|ACGGT|ACGT using efficient motif set [ACGGT, ACGT]. The edit distance between the original VNTR sequence and encoding sequence is 1.
We have released a version 2.1 of the motif set. This has roughly 1.2m loci and uses an additional motif-harmonization step before efficient motif selection. We additionally supply loci for CHM13.
To install vamos, g++ (>= 8.3.0), htslib, abpoa, edlib and alglib are required. htslib and abpoa can be installed through bioconda. Static libraries libalglib.a and libedlib.a are distributed along with vamos.
Install required libraries through conda
conda create --name vamos python=3.10
conda activate vamos
conda install -c bioconda --file requirements.txt
Or download the latest code from github
git clone https://github.com/ChaissonLab/vamos.git
cd vamos*/src/ && make
Building will take several minutes. Running on the example data will complete within seconds.
Next you should download a locus list. These are in BED format, with the coordinates of the tandem repeat as the BED coordinates, and the list of observed motifs from the Human Pangenome Reference Consortium given as the extra field.
The latest motif sets as of v2.1 can be downloaded via: https://zenodo.org/records/13263615
Explanation of the motif catalog columns:
| Column | Explanation |
|---|---|
| 1 | Chromosome of the locus |
| 2 | Start coordinate of the locus |
| 3 | End coordinate of the locus |
| 4 | Motifs of the locus to be used for annotation (separated by ",") |
| 5 | Version of the motif catalog |
| 6 | Type of the locus (VNTR or STR) |
| 7 | Period size (bp) of the motif consensus of the locus |
| 8 | How much proportion the biggest overlap between the locus and a transposable element takes up the TR locus |
| 9 | How much proportion the biggest overlap between the locus and a transposable element takes up the transposable element |
For annotation on GRCh38 using the vamos efficient motifs:
curl "https://zenodo.org/records/13263615/files/vamos.effMotifs-0.1.GRCh38.tsv.gz?download=1" > vamos.effMotifs-0.1.GRCh38.tsv.gz; gunzip vamos.effMotifs-0.1.GRCh38.tsv.gz;
For annotation on CHM13 using the vamos efficient motifs
curl "https://zenodo.org/records/13263615/files/vamos.effMotifs-0.1.T2T-CHM13.tsv.gz?download=1" > vamos.effMotifs-0.1.T2T-CHM13.tsv.gz; gunzip vamos.effMotifs-0.1.T2T-CHM13.tsv.gz
For running vamos on a haplotype-resolved assembly:
vamos --contig -b assembly.hap1.mapped_to_grch38.bam -r vamos.effMotifs-0.1.GRCh38.tsv -s sample_name -o assembly.hap1.vcf -t 8
vamos --contig -b assembly.hap2.mapped_to_grch38.bam -r vamos.effMotifs-0.1.GRCh38.tsv -s sample_name -o assembly.hap2.vcf -t 8
For running vamos on aligned reads:
vamos --read -b ../example/demo.aln.bam -r vamos.effMotifs-0.1.GRCh38.tsv -s NA24385_CCS_h1 -o reads.vcf -t 8
If the reads are pre-phased using HapCut or WhatsHap, and contain the HA SAM tag, this phasing will be used to call variants from each haplotype. If the reads are unphased, a max-cut heuristic will be used to prephase reads before calling variants.
vamos generates single-sample diploid vcf (by the --read mode) or haploid vcf (by the --contig mode).
Explanation of the "INFO" field of an output vcf:
| Field | Explanation |
|---|---|
| END | Ending position of the locus |
| RU | All repeating units (motifs) of the locus ("," separated) |
| SVTYPE | VNTR |
| ALTANNO_H1 | Motif annotations (allels) of haplotyp1, motifs are indexed from "0" as ordered in the "RU" field |
| LEN_H1 | Total count of motifs of haplotyp1 allele |
| ALTANNO_H2 | Motif annotations (allels) of haplotyp2, motifs are indexed from "0" as ordered in the "RU" field |
| LEN_H2 | Total count of motifs of haplotyp2 allele |
The following shows example entries of a diploid single-sample vcf file
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT sample1
chr1 11226 . N <VNTR> . PASS END=11462;RU=AGAGTGGTGGCCAGCGCCCCCTGCTGGCGCCGGGGCACTGCAGGGCCCTCTTGCTT,ACTGTATAGTGGTGGCACGCCGCCTGCTGGCAGCTAGGGACATTGCAGGGTCCTCTTGCTC,AGAGTGGTGGCCACCGCCCCCTGCTGGCGCCGGGGCACTGCAGGGTCCTCTTGCTT,ACTGTATAGTGGTGGCACGCCGCCTGCTGGCAGCTACGGACATTGCAGGGTCCTCTTGCTC,ACTGTATAGTGGTGGCACGCCGCCTGCTGGCAGCTAGGGACATTGCAGGGTCCTCTTGCTCA;SVTYPE=VNTR;ALTANNO_H1=0,0,4,0;LEN_H1=4; GT 1/1
chr1 15796 . N <VNTR> . PASS END=15849;RU=CTT,CTC,CTG,CAG,CATG;SVTYPE=VNTR;ALTANNO_H1=0,1,2,1,0,2,0,0,0,1,3,0,2,1,0,4,2;LEN_H1=17;ALTANNO_H2=0,1,2,1,0,2,2,2,0,1,3,0,2,1,0,4,2;LEN_H2=17; GT 1/2
To cite vamos, you should use: Ren, Jingwen, Bida Gu, and Mark JP Chaisson. "vamos: variable-number tandem repeats annotation using efficient motif sets." Genome Biology 24.1 (2023): 175.
Please refer to tryvamos for more details.